Вы здесь

Цукровий буряк (Beta vulgaris L.) в культурі in vitro : Регенерація, морфогенез і генетична трансформація

Автор: 
Головко Андрій Ерастович
Тип работы: 
Дис. канд. наук
Год: 
2003
Артикул:
0403U003368
99 грн
(320 руб)
Добавить в корзину

Содержимое

РАЗДЕЛ 2
МАТЕРИАЛЫ И МЕТОДЫ
2.1 Растительный материал
Табак (Nicotiana tabacum L.): Сорт табака "Wisconsin 38" использовался в этой работе как модельное растение.
Сахарная свекла (Beta vulgaris L.): В работе использовались семена сахарной свеклы 14 сортов отечественной и зарубежной селекции, любезно предоставленные Институтом сахарной свеклы УААН (Украина), Institut fur Genbiologische Forschung (Германия) и Crystal & Maribo Beet Seeds, Inc. (США).
Эксперименты проводились на растениях сахарной свеклы украинской и зарубежной селекций. Семена сахарной свеклы 5 сортов отечественной селекции, были любезно предоставленны Институтом сахарной свеклы УААН (г. Киев).
- Льговская односемянная-52 (N52)
- Уладовская МС-5 (N5);
- Межотненский гибрид-18 (N18);
- Рамонская односемянная-47 (N47);
- Рамонская МС-54 (N54);
2.2 Реактивы
ВеществоФирма - изготовитель Агар (очищенный)Sigma, St. Louis, USAАгароза (SeaKem) Biozym, HamelnАльгиновая кислота (из Macrocystis pyrifera)Sigma, St. Louis, USAАмпициллин (как Ampicillintrihydrate) Serva Feinbiochemica, HeidelbergБ5 солиSigma, St. Louis, USAБАП Sigma, St. Louis, USAБакто-агар ICN, Ohio, USAБакто-триптон Serva Feinbiochemica, HeidelbergЦеллюлаза "Онозука" R-10 Yakult Pharmaceutical Industry, JapanДезоксинуклеотиды Amersham Buchler, BraunschweigДНК-МАРКЕРЫ: 1 т.п.о.Invitrogen, Carlsbad, USA1 т.п.о. +Invitrogen, Carlsbad, USATaq-полимеразаQIAGEN, HildenДрицеллаза Sigma, St. Louis, USAБромид этидияRoth, Karlsruhe,Глюкоза Bader, Deventer, NederlandsИУК Sigma, St. Louis, USAКинетинSigma, St. Louis, USAМацерозим R-10 Yakult Pharmaceutical Industry, JapanМаннитол Sigma, St. Louis, USAMЭСSigma, St. Louis, USAMS солиSigma, St. Louis, USAНУК Sigma, St. Louis, USAНПГ (n-пропилгаллат) Sigma, St. Louis, USAОлигонуклеотиды Invitrogen, Carlsbad, USAФитагель Sigma, St. Louis, USAПротеиназа K Amersham Buchler, BraunschweigПолиэтиленгликоль 1500 Sigma, St. Louis, USAСахароза ICN, Cleveland, USATИБАSigma, St. Louis, USAТДЗ Sigma, St. Louis, USAX-галBiometra, GottingenX-глюк Sigma, St. Louis, USAЗеатин Sigma, St. Louis, USA Все другие химические вещества, которые не включены в список, были в получены от Baker Chemicals (Phillipsburg, США), Difco (Детройт, США), Merck (Darmstadt), Roth (Karlsruhe), Serva Biochemica (Heidelburg) и Sigma (St. Louis, USA).
2.3 Бактерии и векторы
2.3.1 Векторы
Трансформацию осуществляли, используя плазмидные конструкции, созданные на базе широкоиспользуемого вектора pBin19: 1) pCB004, несущая кодирующую последовательность AtAHAS Ser653Asn гена под нативным промотором и терминирующуюся нативным полиаденилирующим сигналом; в плазмиду также был включен химерный NPTII ген. 2) pCB001, производную от коммерческого вектора pBI101 [Jefferson, 1987] с кодирующей последовательностью гена ?-глюкуронидазы (GUS) под промотором CaMV35S со встроенным интроном растения (с целью исключить бактериальную GUS активность) и терминирующейся полиаденилирующим сигналом нопалин синтазы (NOS), а также химерным NPTII геном. Другие векторы описаны в табл. 2.1.
Используя метод прямой бактериальной трансформации, все векторы были протрансформированны в Agrobacterium tumefaciens, штаммы LBA 4404 или EHA10, несущие инактивированную Ti-плазмиду pMP90.
Конструкции с генами для изменения биосинтеза углеводов были любезно предоставлены Лотаром Вилмитцером, Германия.

Таблица 2.1
Плазмиды и гены, использованные в экспериментальных исследованиях.
Плаз-мидаГен 1Ген 2Векторная основа5'Кодирующая ДНК3'5'Кодирующая ДНК3'pCB00135SGUSNos35SNPTII35SpBIN19pCB00335SAtAHAS Ser653AsnAtAHASpUC19pCB004AtAHASAtAHAS Ser653AsnAtAHASpBIN19рSPSB33 АSPS Б
GUSNos35SNPTII35SpBIN19рINVB33 АINV В
GUSnos35SNPTII35SpBIN19рS21B33 АS21 Г
GUSnos35SNPTII35SpBIN19pPPAB33 АPPA Д
GUSnos35SNPTII35SpBIN19Примечание:
А B33, тканеспецифичный промотор экспрессирующийся в корнях и корнеплодах [Koster-Topfer, 1989];
Б INV, yeast-derived invertase [Sonnewald, 1991];
В PPA, E. coli inorganic pyrophosphatase [Sonnewald, 1992];
Г SPS, spinach leaf sucrose-phosphate synthase [Sonnewald, 1993]; Д S21, spinach sucrose carrier [Riesmeier, 1992].
2.3.2 Бактерии
Для культивирования Agrobacterium tumefaciens использовали агаризованную LB, в качестве селективных агентов использовали канамицин сульфат (50 мг/л) и рифампицин (100 мг/л); бактерии росли на чашках Петри в темноте при 28OС.
2.4 Праймеры
PCR праймеры были разработаны с использованием геномной версии гена AHAS при помощи PCR были разработаны с использованием геномной версии гена AHAS [Sathasivan et al, 1990]:
4R AGTCCAAATCCCATAGCTCC
4F ATGTTAAGCTGGCTTTGCAA
Позитивный сигнал должен быть размером 310 п.о.
2.5 Методы анализа ДНК
Стандартные аналитические методы, используемые в этой работе были описаны Sambrook Y, Fritsh E., Maniatis (1989). Когда это было необходимо использовались методики фирм - изготовителей.
2.5.1 PCR (цепная реакция полимеризации)
Типичные условия для PCR представлены ниже. PCR был выполнен, используя аппарат HYBAID PCR Тhermocycler с подогревом крышки (Hybaid Ltd., Ashford, Великобритания) и реактивы набора для PCR с Taq ДНК полимеразой (Qiagen, Hilden). В случае трудностей с получением ожидаемой амплификации фрагмента, которые могли возникать из-за низкой специфики используемых праймеров, проводилась оптимизация условий PCR. Были проверены различные температуры плавления (Tm) и концентрации хлористого магния.
Шаг Рекомендованные условия
Денатурация 1-3 мин, 94 ?C
Циклическая работа с 3 шагами (30-35 циклов):
Денатурация 1 мин, 94 ?C
Отжиг 0.5 мин, (Tm-5) ?C
Удлинение 1 мин/т.п.о., 72 ?C
Заключительное удлинение 5-10 мин, 72 ?C
Концентрация стандартных компонентов реакции:
Матричная ДНК 0.1-10 нг
Буфер ДНК полимеразы 1x
MgCl2 1.5 мМ
Праймер 1 0.5 мкМ